Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0005402 | |||
Gene | ANXA2 | Organism | Human |
Genome Locus | chr15:60653139-60674640:- | Build | hg19 |
Disease | Multiple Sclerosis | ICD-10 | Multiple sclerosis (G35) |
DBLink | Link to database | PMID | 28651352 |
Experimental Method | |||
Sample Type | Blood samples | Comparison | 45 patients with RR-MS, 10 CIS cases and 26 healthy donors |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward TTTCGGACACATCTGGTGAC ReverseCCGCTCAGCATCAAAGTTAGT | Statistics | Fold Change : Downregulated,6.11 pvalue : p=0.0091 |
Citation | |||
Iparraguirre, L, Munoz-Culla, M, Prada-Luengo, I, Castillo-Trivino, T, Olascoaga, J, Otaegui, D (2017). Circular RNA profiling reveals that circular RNAs from ANXA2 can be used as new biomarkers for multiple sclerosis. Hum. Mol. Genet., 26, 18:3564-3572. |